Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00298 |
---|---|
Accession No | AB067500 |
Description | transmembrane protein 200A, transcript variant 4 |
Clone name | fk05496 |
Vector information | |
cDNA sequence | DNA sequence (3512 bp) Predicted protein sequence (509 aa) |
HaloTag ORF Clone |
FHC00298
|
Flexi ORF Clone | FXC00298 |
Source | Human fetal brain |
Rouge ID |
mKIAA1913
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1165 bp |
---|---|
Genome contig ID | gi89161210f_130628572 |
PolyA signal sequence (AATAAA,-30) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (177331 - 177380) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 130728572 | 130805901 | 3 | 100.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 15 | KGQAMIATGGVITGLAAL | 32 | SECONDARY | 18 | 2 | 74 | RLYSPSGFFLILGVLISIIGIAM | 96 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GTTTGGGTTACTTGTGACTGC |
---|---|
Primer_r | GTACTCCTGGTCCACACTTTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |