Order Kazusa clone(s) from : ![]() |
Product ID | ORK00950 |
---|---|
Accession No | AB067504 |
Description | ring finger protein 157 |
Clone name | fk00028 |
Vector information | |
cDNA sequence | DNA sequence (3570 bp) Predicted protein sequence (702 aa) |
Flexi ORF Clone | FXC00950 |
Source | Human fetal brain |
Rouge ID |
mKIAA1917
by Kazusa Mouse cDNA Project
|
Note | We replaced hj00666, former representative clones for KIAA1917 with fk00028. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1461 bp |
---|---|
Genome contig ID | gi51511734r_71551583 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99868 - 99819) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 71651451 | 71747985 | 19 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AGGCCAGTAAAGCTAAAGTCC |
---|---|
Primer_r | AGGCTGTTGTCTTTGGGAATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |