KIAA0544

Product ID	ORK00557
Accession No	AB011116
Description	mahogunin ring finger 1, E3 ubiquitin protein ligase, transcript variant 3
Clone name	hg04431
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6450 bp) Predicted protein sequence (583 aa)
HaloTag ORF Clone	FHC00557
Flexi ORF Clone	FXC00557
Source	Human adult brain
Rouge ID	mKIAA0544 by Kazusa Mouse cDNA Project

Length: 6450 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4698 bp
Genome contig ID	gi51511732f_4514870
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ACTGTATATTTATAGTAATAAAATCATGCAGCAAT
Flanking genome sequence (166107 - 166156)	----+--------+--------+--------+--------+----* ATCCTGTCTGCTCCTTCCTCCGGGTGCAGCCCTCAGGATTGTGGCTGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	4614870	4680975	19	99.1	Internal No-hit

Length: 583 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O60291	8.5e-213	100.0	Probable E3 ubi...	Homo sapiens
XP_510786	7.6e-211	96.0	mahogunin, ring...	Pan troglodytes
AAH50389	2.3e-207	100.0	Mahogunin, ring...	Homo sapiens
XP_001367486	4.7e-191	89.0	similar to Prob...	Monodelphis dom...
NP_001070410	2.1e-182	87.9	mahogunin, ring...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067504	6.4e-66	57.2	KIAA1917

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	309	347	PF00097	Zinc finger
HMMSmart	IPR001841	309	347	SM00184	Zinc finger
ProfileScan	IPR001841	309	348	PS50089	Zinc finger

Primer_f	CTTTCCATCCCTAGTTCAGAG
Primer_r	GCTTCGACCACCAATCAGTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTTTCCATCCCTAGTTCAGAG
Primer_r	GCTTCGACCACCAATCAGTTC
PCR product length	172 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles