KIAA1918

Product ID	ORK05262
Accession No	AB067505
Description	polypeptide N-acetylgalactosaminyltransferase 13
Clone name	hj01313
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4978 bp) Predicted protein sequence (516 aa)
Source	Human adult brain

Length: 4978 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3425 bp
Genome contig ID	gi89161199f_154605095
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TGAAATATGAAATTTTATTAAAATGCTGCTATATT
Flanking genome sequence (413641 - 413690)	----+--------+--------+--------+--------+----* ACATAAGTTGCTTCATTAAGCTAAAAATGGTTTTTATTTTTTGGTTGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	154705090	155018734	10	99.2	Terminal No-hit

Length: 516 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IUC8	100.0	Polypeptide N-a...	Homo sapiens
BAC54545	100.0	UDP-N-acetyl-al...	Homo sapiens
AAI23663	99.6	UDP-N-acetyl-al...	Bos taurus
Q8CF93	99.4	Polypeptide N-a...	Mus musculus
Q6UE39	99.4	Polypeptide N-a...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032956	7.8e-78	44.6	KIAA1130

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001173	78	262	PF00535	Glycosyl transferase
HMMPfam	IPR000772	389	507	PF00652	Ricin B lectin
HMMSmart	IPR000772	387	510	SM00458	Ricin B lectin
ProfileScan	IPR000772	398	510	PS50231	Ricin B lectin

Primer_f	GCTGACAAAGAAATCCGAACC
Primer_r	TCATCGAGACATTGGTTACTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-