KIAA1130

Product ID	ORK00745
Accession No	AB032956
Description	polypeptide N-acetylgalactosaminyltransferase 16
Clone name	hh00715
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5548 bp) Predicted protein sequence (575 aa)
HaloTag ORF Clone	FHC00745
Flexi ORF Clone	FXC00745
Source	Human adult brain
Rouge ID	mKIAA1130 by Kazusa Mouse cDNA Project

Length: 5548 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3802 bp
Genome contig ID	gi51511730f_68696644
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ACACACACCTGGAATAAAACCACTTCTTACATGTC
Flanking genome sequence (194294 - 194343)	----+--------+--------+--------+--------+----* CACATGCACCAGCGCCTTCCTTTCTGCCTCCAGGCCTAGCCCTTCAGCAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	68796644	68890936	15	100.0	Perfect prediction

Length: 575 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_522885	100.0	UDP-N-acetyl-al...	Pan troglodytes
BAD93178	100.0	UDP-N-acetyl-al...	Homo sapiens
XP_001104403	98.0	UDP-N-acetyl-al...	Macaca mulatta
Q8N428	100.0	Putative polype...	Homo sapiens
AAH98578	99.8	UDP-N-acetyl-al...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067505	1.5e-69	44.6	KIAA1918

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001173	159	341	PF00535	Glycosyl transferase
HMMPfam	IPR000772	464	546	PF00652	Ricin B lectin
ProfileScan	IPR000772	474	540	PS50231	Ricin B lectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	38	RANAIAILTVAWILGTFYYLWQD	60	PRIMARY	23

Primer_f	ATCCTGGGCACTTTCTACTAC
Primer_r	ACAATGAGCGGGATGGTGCGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCAGGCACTTCCGTAATGTTC
Primer_r	ATCACAGAGTCATGCAGGGGC
PCR product length	117 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles