KIAA1922

Product ID	ORK04635
Accession No	AB067509
Description	Homo sapiens mRNA for KIAA1922 protein, partial cds.
Clone name	fh11169
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5369 bp) Predicted protein sequence (370 aa)
Source	Human fetal brain

Length: 5369 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2699 bp
Genome contig ID	gi89161185r_16566518
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AGAAGCATTAAATAAACGCTGTAATTTAAAATGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATCCCATTCTCTACACTACAGAAATATCTGCAGGAGTGACCAAAGATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	16666518	16691783	15	99.2	Perfect prediction

Length: 370 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8IVE0	1.4e-83	100.0	Ciliary rootlet...	Homo sapiens
AAI26913	1.3e-59	91.7	CROCC protein [...	Homo sapiens
AAI26912	1.3e-59	91.7	CROCC protein [...	Homo sapiens
CAH70057	1.8e-59	91.7	ciliary rootlet...	Homo sapiens
Q5TZA2	1.8e-59	91.7	Rootletin; Cili...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007914	5.9e-34	91.7	KIAA0445

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	GCTTCCGTTCCCTTATAGTAG
Primer_r	TATGCAGCCAGGATGAAATTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-