KIAA1927

Product ID	ORK01185
Accession No	AB067514
Description	sperm specific antigen 2, transcript variant 1
Clone name	hj03131
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5167 bp) Predicted protein sequence (1325 aa)
HaloTag ORF Clone	FHC01185
Flexi ORF Clone	FXC01185
Source	Human adult brain
Rouge ID	mKIAA1927 by Kazusa Mouse cDNA Project
Note	We replaced ah01387, former representative clones for KIAA1927 with hj03131. (2003/8/28)

Length: 5167 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1188 bp
Genome contig ID	gi89161199f_182364915
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATATATATTAAAACAATAAAGTATTTATTTTGCCT
Flanking genome sequence (138794 - 138843)	----+--------+--------+--------+--------+----* AAAGTGTTTTAGTGGTTTCTTAAACTGCAACATGAAGATTTTGAATTAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	182464840	182503707	18	99.5	Perfect prediction

Length: 1325 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11373	100.0	sperm-specific ...	synthetic construct
P28290	99.9	Sperm-specific ...	Homo sapiens
AAH28706	99.8	Sperm specific ...	Homo sapiens
XP_001101290	96.5	similar to sper...	Macaca mulatta
BAC05027	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018291	3.4e-09	30.6	KIAA0748

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	1059	1325	PD120214	NULL

Primer_f	GCAAGTCAGCATTCCGATAGC
Primer_r	TAACTGTTGTCTCACTGTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-