KIAA1950

Product ID	ORK01641
Accession No	AB075830
Description	archaelysin family metallopeptidase 1, transcript variant 1
Clone name	fj03308
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4415 bp) Predicted protein sequence (535 aa)
HaloTag ORF Clone	FHC01641
Flexi ORF Clone	FXC01641
Source	Human fetal brain
Rouge ID	mKIAA1950 by Kazusa Mouse cDNA Project

Length: 4415 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2557 bp
Genome contig ID	gi89161213f_2585689
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- GGAGTGATGCGAGATTAAACAGAGGTGATAAAAAT
Flanking genome sequence (135908 - 135957)	----+--------+--------+--------+--------+----* AGAATGCCTGGCTCATGCTGAGGGTGGGAGCCCACTGGGGTTATGACCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	2685689	2721595	7	99.2	Perfect prediction

Length: 535 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001139882	0	96.6	archaemetzincin...	Pan troglodytes
XP_001087225	4.7e-197	94.0	similar to arch...	Macaca mulatta
XP_547006	1.2e-162	74.7	hypothetical pr...	Canis lupus fam...
Q400C9	1.5e-155	75.4	Archaemetzincin...	Rattus norvegicus
Q8BVF9	3.1e-152	73.5	Archaemetzincin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR006025	295	304	PS00142	Peptidase M

Primer_f	TGTATGTGTCCGCCTTCTCCC
Primer_r	GTAGGTAGATGTGCTTCCGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-