Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00953 |
---|---|
Accession No | AB075831 |
Description | zinc finger protein 526 |
Clone name | fj05532 |
Vector information | |
cDNA sequence | DNA sequence (3954 bp) Predicted protein sequence (679 aa) |
HaloTag ORF Clone |
FHC00953
|
Flexi ORF Clone | FXC00953 |
Source | Human fetal brain |
Rouge ID |
mKIAA1951
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 369 | 392 | PD000003 | Zinc finger |
IPR007087 | 537 | 559 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 149 | 172 | PF00096 | Zinc finger |
IPR007087 | 206 | 228 | PF00096 | Zinc finger | |
IPR007087 | 314 | 336 | PF00096 | Zinc finger | |
IPR007087 | 341 | 363 | PF00096 | Zinc finger | |
IPR007087 | 369 | 391 | PF00096 | Zinc finger | |
IPR007087 | 451 | 474 | PF00096 | Zinc finger | |
IPR007087 | 481 | 503 | PF00096 | Zinc finger | |
IPR007087 | 509 | 531 | PF00096 | Zinc finger | |
IPR007087 | 537 | 559 | PF00096 | Zinc finger | |
IPR007087 | 582 | 604 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 66 | 88 | SM00355 | Zinc finger |
IPR015880 | 117 | 139 | SM00355 | Zinc finger | |
IPR015880 | 149 | 172 | SM00355 | Zinc finger | |
IPR015880 | 206 | 228 | SM00355 | Zinc finger | |
IPR015880 | 282 | 305 | SM00355 | Zinc finger | |
IPR015880 | 314 | 336 | SM00355 | Zinc finger | |
IPR015880 | 341 | 363 | SM00355 | Zinc finger | |
IPR015880 | 369 | 391 | SM00355 | Zinc finger | |
IPR015880 | 397 | 418 | SM00355 | Zinc finger | |
IPR015880 | 451 | 474 | SM00355 | Zinc finger | |
IPR015880 | 481 | 503 | SM00355 | Zinc finger | |
IPR015880 | 509 | 531 | SM00355 | Zinc finger | |
IPR015880 | 537 | 559 | SM00355 | Zinc finger | |
IPR015880 | 582 | 604 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 66 | 88 | PS50157 | Zinc finger |
IPR007087 | 117 | 144 | PS50157 | Zinc finger | |
IPR007087 | 314 | 341 | PS50157 | Zinc finger | |
IPR007087 | 341 | 368 | PS50157 | Zinc finger | |
IPR007087 | 369 | 396 | PS50157 | Zinc finger | |
IPR007087 | 397 | 423 | PS50157 | Zinc finger | |
IPR007087 | 451 | 479 | PS50157 | Zinc finger | |
IPR007087 | 481 | 508 | PS50157 | Zinc finger | |
IPR007087 | 509 | 536 | PS50157 | Zinc finger | |
IPR007087 | 537 | 559 | PS50157 | Zinc finger | |
IPR007087 | 582 | 609 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 68 | 88 | PS00028 | Zinc finger |
IPR007087 | 119 | 139 | PS00028 | Zinc finger | |
IPR007087 | 151 | 172 | PS00028 | Zinc finger | |
IPR007087 | 208 | 228 | PS00028 | Zinc finger | |
IPR007087 | 316 | 336 | PS00028 | Zinc finger | |
IPR007087 | 343 | 363 | PS00028 | Zinc finger | |
IPR007087 | 371 | 391 | PS00028 | Zinc finger | |
IPR007087 | 453 | 474 | PS00028 | Zinc finger | |
IPR007087 | 483 | 503 | PS00028 | Zinc finger | |
IPR007087 | 511 | 531 | PS00028 | Zinc finger | |
IPR007087 | 539 | 559 | PS00028 | Zinc finger | |
IPR007087 | 584 | 604 | PS00028 | Zinc finger |
RT-PCR-ELISA |
Primer_f | CGGCTTTGGCACAGAACTCAC |
---|---|
Primer_r | TGGTAGAGGAACTTGGTCATG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |