Gene/Protein Characteristic Table for KIAA1951
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00953
Accession No AB075831
Description zinc finger protein 526
Clone name fj05532
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3954 bp)
Predicted protein sequence (679 aa)
Flexi ORF Clone FXC00953
Source Human fetal brain
Rouge ID mKIAA1951 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3954 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 679 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8TF50 1e-199 100.0 Zinc finger pro...
Homo sapiens
AAH13013 2.2e-199 99.9 Zinc finger pro...
Homo sapiens
XP_001153402 3.1e-198 99.1 zinc finger pro...
Pan troglodytes
XP_001105042 1.7e-197 98.7 similar to zinc...
Macaca mulatta
XP_541591 4e-179 88.1 similar to zinc...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB040941 1.4e-13 31.3 KIAA1508
AB107355 2.2e-13 26.9 KIAA2033
AB075836 5.8e-13 28.6 KIAA1956
AB058774 1.1e-12 28.3 KIAA1871
AB075827 1.5e-12 27.5 KIAA1947
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 369 392 PD000003 Zinc finger
IPR007087 537 559 PD000003 Zinc finger
HMMPfam IPR007087 149 172 PF00096 Zinc finger
IPR007087 206 228 PF00096 Zinc finger
IPR007087 314 336 PF00096 Zinc finger
IPR007087 341 363 PF00096 Zinc finger
IPR007087 369 391 PF00096 Zinc finger
IPR007087 451 474 PF00096 Zinc finger
IPR007087 481 503 PF00096 Zinc finger
IPR007087 509 531 PF00096 Zinc finger
IPR007087 537 559 PF00096 Zinc finger
IPR007087 582 604 PF00096 Zinc finger
HMMSmart IPR015880 66 88 SM00355 Zinc finger
IPR015880 117 139 SM00355 Zinc finger
IPR015880 149 172 SM00355 Zinc finger
IPR015880 206 228 SM00355 Zinc finger
IPR015880 282 305 SM00355 Zinc finger
IPR015880 314 336 SM00355 Zinc finger
IPR015880 341 363 SM00355 Zinc finger
IPR015880 369 391 SM00355 Zinc finger
IPR015880 397 418 SM00355 Zinc finger
IPR015880 451 474 SM00355 Zinc finger
IPR015880 481 503 SM00355 Zinc finger
IPR015880 509 531 SM00355 Zinc finger
IPR015880 537 559 SM00355 Zinc finger
IPR015880 582 604 SM00355 Zinc finger
ProfileScan IPR007087 66 88 PS50157 Zinc finger
IPR007087 117 144 PS50157 Zinc finger
IPR007087 314 341 PS50157 Zinc finger
IPR007087 341 368 PS50157 Zinc finger
IPR007087 369 396 PS50157 Zinc finger
IPR007087 397 423 PS50157 Zinc finger
IPR007087 451 479 PS50157 Zinc finger
IPR007087 481 508 PS50157 Zinc finger
IPR007087 509 536 PS50157 Zinc finger
IPR007087 537 559 PS50157 Zinc finger
IPR007087 582 609 PS50157 Zinc finger
ScanRegExp IPR007087 68 88 PS00028 Zinc finger
IPR007087 119 139 PS00028 Zinc finger
IPR007087 151 172 PS00028 Zinc finger
IPR007087 208 228 PS00028 Zinc finger
IPR007087 316 336 PS00028 Zinc finger
IPR007087 343 363 PS00028 Zinc finger
IPR007087 371 391 PS00028 Zinc finger
IPR007087 453 474 PS00028 Zinc finger
IPR007087 483 503 PS00028 Zinc finger
IPR007087 511 531 PS00028 Zinc finger
IPR007087 539 559 PS00028 Zinc finger
IPR007087 584 604 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CGGCTTTGGCACAGAACTCAC
Primer_r TGGTAGAGGAACTTGGTCATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp