KIAA1955

Product ID	ORK04777
Accession No	AB075835
Description	DIS3 like exosome 3'-5' exoribonuclease
Clone name	fk07007
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3260 bp) Predicted protein sequence (947 aa)
Source	Human fetal brain
Rouge ID	mKIAA1955 by Kazusa Mouse cDNA Project

Length: 3260 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	416 bp
Genome contig ID	gi51511731f_64274489
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTCCAGCCTGGGCAACAGAGCGAGACTCCATCTC
Flanking genome sequence (138633 - 138682)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAGTTCTCTCATTCATTAAAGTTGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	64374489	64413120	16	99.7	Perfect prediction

Length: 947 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH22089	99.9	DIS3 mitotic co...	Homo sapiens
Q8TF46	99.9	DIS3-like exonu...	Homo sapiens
XP_001174664	99.6	hypothetical pr...	Pan troglodytes
XP_001174660	99.6	hypothetical pr...	Pan troglodytes
XP_001174669	99.6	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023225	4.6e-52	36.8	KIAA1008
AB051556	2.8e-20	24.7	KIAA1769

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001900	358	710	PF00773	Ribonuclease II and R
ScanRegExp	IPR001900	677	701	PS01175	Ribonuclease II and R

Primer_f	CCTTAAATAATGGCAACCTGG
Primer_r	CAGTTCCCACATGATGCTTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-