Order Kazusa clone(s) from : ![]() |
Product ID | ORK01142 |
---|---|
Accession No | AB023225 |
Description | DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease, transcript variant 2 |
Clone name | hh04776s1 |
Vector information | |
cDNA sequence | DNA sequence (5231 bp) Predicted protein sequence (935 aa) |
Flexi ORF Clone | FXC01142 |
Source | Human adult brain |
Rouge ID |
mKIAA1008
by Kazusa Mouse cDNA Project
|
Note | We replaced hh04776, former representative clones for KIAA1008 with hh04776s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2351 bp |
---|---|
Genome contig ID | gi51511729r_72129866 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99716 - 99667) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 13 | r | 72229582 | 72254064 | 21 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CTTCCCTTGCTAATCACAGAG |
---|---|
Primer_r | TGGAACCTGGCACAACGTAAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |