Gene/Protein Characteristic Table for KIAA1968
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04075
Accession No AB075848
Description AT-hook transcription factor
Clone name fk04713
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3334 bp)
Predicted protein sequence (860 aa)
Source Human fetal brain
Rouge ID mKIAA1968 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3334 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 503 bp
Genome contig ID gi89161216r_116061470
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGTGATAGTGTGAGACCCTGTCTC
Flanking genome sequence
(99718 - 99669)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGAAAAAAGAATATCATTCTCTTTTTCTGTCTCTGACC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 9 r 116161188 116190182 11 99.7 Perfect prediction
Features of the protein sequence
Description

Length: 860 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAC85132 0 99.9 FLJ00281 protei...
Homo sapiens
BAD18725 0 99.8 FLJ00356 protei...
Homo sapiens
CAI16863 0 99.9 AT-hook transcr...
Homo sapiens
AAH55285 0 99.9 AT-hook transcr...
Homo sapiens
Q7Z591 0 99.9 AT-hook-contain...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CAAGTCCAGAAGCCACAACAG
Primer_r CGTCTGAAATTCTTGGGGTAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 9
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp