KIAA1971

Product ID	ORK00962
Accession No	AB075851
Description	WAS protein homolog associated with actin, golgi membranes and microtubules
Clone name	fk08985
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3637 bp) Predicted protein sequence (830 aa)
HaloTag ORF Clone	FHC00962
Flexi ORF Clone	FXC00962
Source	Human fetal brain
Rouge ID	mKIAA1971 by Kazusa Mouse cDNA Project

Length: 3637 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1122 bp
Genome contig ID	gi51511731f_81175448
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTATCAGTAATCAGAATAAATTGCTTATATTCAGG
Flanking genome sequence (125018 - 125067)	----+--------+--------+--------+--------+----* AGTTATTTTAAATATTTAAATGAAATTTATTTTAGGCACCAAGCACTACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	81275448	81300464	10	100.0	Perfect prediction

Length: 830 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8TF30	0	100.0	WASP homolog as...	Homo sapiens
XP_510552	0	98.4	WAS protein hom...	Pan troglodytes
XP_001927350	4.9e-182	77.8	WAS protein hom...	Sus scrofa
XP_001082027	1e-160	95.1	similar to WAS ...	Macaca mulatta
EDM08696	1.4e-148	66.8	similar to junc...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003124	760	777	PF02205	Actin-binding WH2
ProfileScan	IPR003124	760	777	PS51082	Actin-binding WH2

Primer_f	CGCCAGGTTATTCAAGGACAC
Primer_r	AATGGCTGCAATAAGTACTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-