KIAA1994

Product ID	ORK00967
Accession No	AB082525
Description	TSC22 domain family, member 1, transcript variant 1
Clone name	bh00052
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (4815 bp) Predicted protein sequence (1117 aa)
HaloTag ORF Clone	FHC00967
Flexi ORF Clone	FXC00967
Source	Human adult brain
Rouge ID	mKIAA1994 by Kazusa Mouse cDNA Project

Length: 4815 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1102 bp
Genome contig ID	gi51511729r_43805661
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTTGTCAACTTTCAATAAAGCATATAAATGTTGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACAAGTGTTTTTCATATGACCCTGTTAACATAATGGCAGTCATTTCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	r	43905661	44048701	3	99.0	Perfect prediction

Length: 1117 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15714	100.0	TSC22 domain fa...	Homo sapiens
NP_904358	99.9	TSC22 domain fa...	Homo sapiens
Q5R4H1	98.2	TSC22 domain fa...	Pongo abelii
XP_534128	88.8	similar to TSC2...	Canis lupus fam...
P62500	85.6	TSC22 domain fa...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014569	5.8e-10	31.5	KIAA0669

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000580	1032	1087	PD007152	TSC-22 / Dip / Bun
HMMPfam	IPR000580	1032	1091	PF01166	TSC-22 / Dip / Bun
ScanRegExp	IPR000580	1032	1048	PS01289	TSC-22 / Dip / Bun

Primer_f	CGAAAGAGACGTGAGACTGAC
Primer_r	CTCCTGAGCATGAATTAAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-