Order Kazusa clone(s) from : ![]() |
Product ID | ORK00601 |
---|---|
Accession No | AB014569 |
Description | TSC22 domain family, member 2, transcript variant 1 |
Clone name | hk02346 |
Vector information | |
cDNA sequence | DNA sequence (4550 bp) Predicted protein sequence (825 aa) |
HaloTag ORF Clone |
FHC00601
![]() |
Flexi ORF Clone | FXC00601 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000580 | 739 | 793 | PD007152 | TSC-22 / Dip / Bun |
HMMPfam | IPR000580 | 739 | 799 | PF01166 | TSC-22 / Dip / Bun |
ScanRegExp | IPR000580 | 739 | 755 | PS01289 | TSC-22 / Dip / Bun |
![]() |
---|
Primer_f | ATCCTGGTAGCACTTCTCAAC |
---|---|
Primer_r | TGCTGAGGAGACATTCGGCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCGGCTGAATTAGGCATCTCC |
Primer_r | CAATTCAATTCCCTCAGAGGC |
PCR product length | 294 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |