Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00968 |
---|---|
Accession No | AB095924 |
Description | zinc finger protein 154, transcript variant 1 |
Clone name | ah02593 |
Vector information | |
cDNA sequence | DNA sequence (5687 bp) Predicted protein sequence (460 aa) |
HaloTag ORF Clone |
FHC00968
|
Flexi ORF Clone | FXC00968 |
Source | Human brain (amygdala) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 4176 bp |
---|---|
Genome contig ID | gi42406306r_62800946 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99601 - 99552) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 62900547 | 62912348 | 4 | 99.1 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 184 | 207 | PD000003 | Zinc finger |
IPR007087 | 212 | 235 | PD000003 | Zinc finger | |
IPR007087 | 240 | 263 | PD000003 | Zinc finger | |
IPR007087 | 268 | 291 | PD000003 | Zinc finger | |
IPR007087 | 296 | 318 | PD000003 | Zinc finger | |
IPR007087 | 324 | 347 | PD000003 | Zinc finger | |
IPR007087 | 352 | 375 | PD000003 | Zinc finger | |
IPR007087 | 380 | 403 | PD000003 | Zinc finger | |
IPR007087 | 408 | 431 | PD000003 | Zinc finger | |
IPR007087 | 436 | 459 | PD000003 | Zinc finger | |
HMMPfam | IPR001909 | 37 | 77 | PF01352 | KRAB box |
IPR007087 | 184 | 206 | PF00096 | Zinc finger | |
IPR007087 | 212 | 234 | PF00096 | Zinc finger | |
IPR007087 | 240 | 262 | PF00096 | Zinc finger | |
IPR007087 | 268 | 290 | PF00096 | Zinc finger | |
IPR007087 | 296 | 318 | PF00096 | Zinc finger | |
IPR007087 | 324 | 346 | PF00096 | Zinc finger | |
IPR007087 | 352 | 374 | PF00096 | Zinc finger | |
IPR007087 | 380 | 402 | PF00096 | Zinc finger | |
IPR007087 | 408 | 430 | PF00096 | Zinc finger | |
IPR007087 | 436 | 458 | PF00096 | Zinc finger | |
HMMSmart | IPR001909 | 37 | 102 | SM00349 | KRAB box |
IPR015880 | 184 | 206 | SM00355 | Zinc finger | |
IPR015880 | 212 | 234 | SM00355 | Zinc finger | |
IPR015880 | 240 | 262 | SM00355 | Zinc finger | |
IPR015880 | 268 | 290 | SM00355 | Zinc finger | |
IPR015880 | 296 | 318 | SM00355 | Zinc finger | |
IPR015880 | 324 | 346 | SM00355 | Zinc finger | |
IPR015880 | 352 | 374 | SM00355 | Zinc finger | |
IPR015880 | 380 | 402 | SM00355 | Zinc finger | |
IPR015880 | 408 | 430 | SM00355 | Zinc finger | |
IPR015880 | 436 | 458 | SM00355 | Zinc finger | |
ProfileScan | IPR001909 | 37 | 111 | PS50805 | KRAB box |
IPR007087 | 184 | 211 | PS50157 | Zinc finger | |
IPR007087 | 212 | 239 | PS50157 | Zinc finger | |
IPR007087 | 240 | 267 | PS50157 | Zinc finger | |
IPR007087 | 268 | 295 | PS50157 | Zinc finger | |
IPR007087 | 296 | 323 | PS50157 | Zinc finger | |
IPR007087 | 324 | 351 | PS50157 | Zinc finger | |
IPR007087 | 352 | 379 | PS50157 | Zinc finger | |
IPR007087 | 380 | 407 | PS50157 | Zinc finger | |
IPR007087 | 408 | 435 | PS50157 | Zinc finger | |
IPR007087 | 436 | 460 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 186 | 206 | PS00028 | Zinc finger |
IPR007087 | 214 | 234 | PS00028 | Zinc finger | |
IPR007087 | 242 | 262 | PS00028 | Zinc finger | |
IPR007087 | 270 | 290 | PS00028 | Zinc finger | |
IPR007087 | 298 | 318 | PS00028 | Zinc finger | |
IPR007087 | 326 | 346 | PS00028 | Zinc finger | |
IPR007087 | 354 | 374 | PS00028 | Zinc finger | |
IPR007087 | 382 | 402 | PS00028 | Zinc finger | |
IPR007087 | 410 | 430 | PS00028 | Zinc finger | |
IPR007087 | 438 | 458 | PS00028 | Zinc finger |
RT-PCR-ELISA |
Primer_f | TCAGAAGCAATGTGGGCAGAG |
---|---|
Primer_r | AGTGTGAGCAGCCTGTTGATG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |