Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00506 |
---|---|
Accession No | AB002324 |
Description | zinc finger protein 629 |
Clone name | hg00579 |
Vector information | |
cDNA sequence | DNA sequence (6045 bp) Predicted protein sequence (927 aa) |
HaloTag ORF Clone |
FHC00506
|
Flexi ORF Clone | FXC00506 |
Source | Human adult brain |
Rouge ID |
mKIAA0326
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 208 | 231 | PD000003 | Zinc finger |
IPR007087 | 238 | 259 | PD000003 | Zinc finger | |
IPR007087 | 264 | 287 | PD000003 | Zinc finger | |
IPR007087 | 292 | 315 | PD000003 | Zinc finger | |
IPR007087 | 320 | 343 | PD000003 | Zinc finger | |
IPR007087 | 348 | 370 | PD000003 | Zinc finger | |
IPR007087 | 376 | 399 | PD000003 | Zinc finger | |
IPR007087 | 404 | 426 | PD000003 | Zinc finger | |
IPR007087 | 432 | 455 | PD000003 | Zinc finger | |
IPR007087 | 460 | 482 | PD000003 | Zinc finger | |
IPR007087 | 488 | 511 | PD000003 | Zinc finger | |
IPR007087 | 516 | 539 | PD000003 | Zinc finger | |
IPR007087 | 544 | 566 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 208 | 230 | PF00096 | Zinc finger |
IPR007087 | 236 | 258 | PF00096 | Zinc finger | |
IPR007087 | 264 | 286 | PF00096 | Zinc finger | |
IPR007087 | 292 | 314 | PF00096 | Zinc finger | |
IPR007087 | 320 | 342 | PF00096 | Zinc finger | |
IPR007087 | 348 | 370 | PF00096 | Zinc finger | |
IPR007087 | 376 | 398 | PF00096 | Zinc finger | |
IPR007087 | 404 | 426 | PF00096 | Zinc finger | |
IPR007087 | 432 | 454 | PF00096 | Zinc finger | |
IPR007087 | 460 | 482 | PF00096 | Zinc finger | |
IPR007087 | 488 | 510 | PF00096 | Zinc finger | |
IPR007087 | 516 | 538 | PF00096 | Zinc finger | |
IPR007087 | 544 | 566 | PF00096 | Zinc finger | |
IPR007087 | 572 | 594 | PF00096 | Zinc finger | |
IPR007087 | 627 | 649 | PF00096 | Zinc finger | |
IPR007087 | 720 | 742 | PF00096 | Zinc finger | |
IPR007087 | 772 | 794 | PF00096 | Zinc finger | |
IPR007087 | 826 | 848 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 208 | 230 | SM00355 | Zinc finger |
IPR015880 | 236 | 258 | SM00355 | Zinc finger | |
IPR015880 | 264 | 286 | SM00355 | Zinc finger | |
IPR015880 | 292 | 314 | SM00355 | Zinc finger | |
IPR015880 | 320 | 342 | SM00355 | Zinc finger | |
IPR015880 | 348 | 370 | SM00355 | Zinc finger | |
IPR015880 | 376 | 398 | SM00355 | Zinc finger | |
IPR015880 | 404 | 426 | SM00355 | Zinc finger | |
IPR015880 | 432 | 454 | SM00355 | Zinc finger | |
IPR015880 | 460 | 482 | SM00355 | Zinc finger | |
IPR015880 | 488 | 510 | SM00355 | Zinc finger | |
IPR015880 | 516 | 538 | SM00355 | Zinc finger | |
IPR015880 | 544 | 566 | SM00355 | Zinc finger | |
IPR015880 | 572 | 594 | SM00355 | Zinc finger | |
IPR015880 | 627 | 649 | SM00355 | Zinc finger | |
IPR015880 | 720 | 742 | SM00355 | Zinc finger | |
IPR015880 | 772 | 794 | SM00355 | Zinc finger | |
IPR015880 | 826 | 848 | SM00355 | Zinc finger | |
IPR015880 | 900 | 922 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 208 | 235 | PS50157 | Zinc finger |
IPR007087 | 236 | 263 | PS50157 | Zinc finger | |
IPR007087 | 264 | 291 | PS50157 | Zinc finger | |
IPR007087 | 292 | 319 | PS50157 | Zinc finger | |
IPR007087 | 320 | 347 | PS50157 | Zinc finger | |
IPR007087 | 348 | 375 | PS50157 | Zinc finger | |
IPR007087 | 376 | 403 | PS50157 | Zinc finger | |
IPR007087 | 404 | 431 | PS50157 | Zinc finger | |
IPR007087 | 432 | 459 | PS50157 | Zinc finger | |
IPR007087 | 460 | 487 | PS50157 | Zinc finger | |
IPR007087 | 488 | 515 | PS50157 | Zinc finger | |
IPR007087 | 516 | 543 | PS50157 | Zinc finger | |
IPR007087 | 544 | 571 | PS50157 | Zinc finger | |
IPR007087 | 572 | 599 | PS50157 | Zinc finger | |
IPR007087 | 627 | 654 | PS50157 | Zinc finger | |
IPR007087 | 720 | 747 | PS50157 | Zinc finger | |
IPR007087 | 772 | 799 | PS50157 | Zinc finger | |
IPR007087 | 826 | 853 | PS50157 | Zinc finger | |
IPR007087 | 900 | 924 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 210 | 230 | PS00028 | Zinc finger |
IPR007087 | 238 | 258 | PS00028 | Zinc finger | |
IPR007087 | 266 | 286 | PS00028 | Zinc finger | |
IPR007087 | 294 | 314 | PS00028 | Zinc finger | |
IPR007087 | 322 | 342 | PS00028 | Zinc finger | |
IPR007087 | 350 | 370 | PS00028 | Zinc finger | |
IPR007087 | 378 | 398 | PS00028 | Zinc finger | |
IPR007087 | 406 | 426 | PS00028 | Zinc finger | |
IPR007087 | 434 | 454 | PS00028 | Zinc finger | |
IPR007087 | 462 | 482 | PS00028 | Zinc finger | |
IPR007087 | 490 | 510 | PS00028 | Zinc finger | |
IPR007087 | 518 | 538 | PS00028 | Zinc finger | |
IPR007087 | 546 | 566 | PS00028 | Zinc finger | |
IPR007087 | 574 | 594 | PS00028 | Zinc finger | |
IPR007087 | 629 | 649 | PS00028 | Zinc finger | |
IPR007087 | 722 | 742 | PS00028 | Zinc finger | |
IPR007087 | 774 | 794 | PS00028 | Zinc finger | |
IPR007087 | 828 | 848 | PS00028 | Zinc finger | |
IPR007087 | 902 | 922 | PS00028 | Zinc finger |
RT-PCR |
---|
Primer_f | ACTAAGCAACATGACCACCAG |
---|---|
Primer_r | AGACTCCTTTGCCCTCACTAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACTAAGCAACATGACCACCAG |
Primer_r | AGACTCCTTTGCCCTCACTAG |
PCR product length | 128 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |