Gene/Protein Characteristic Table for KIAA2008
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01642
Accession No AB235153
Description mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B, transcript variant 3
Clone name fj04470
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4491 bp)
Predicted protein sequence (793 aa)
Flexi ORF Clone FXC01642
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 4491 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1538 bp
Genome contig ID gi51511734f_72276133
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ATTTCTTGAAATAATAAATATTTTATTGGGATGTG
Flanking genome sequence
(181923 - 181972)
----+----*----+----*----+----*----+----*----+----*
AGGTGCAGAAGAGGAACTGTGCTGGATTCTCGTCTTTTCCTGCGGCATCC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 17 f 72376133 72458054 17 99.5 Perfect prediction
Features of the protein sequence
Description

Length: 793 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE44474 0 100.0 hypothetical pr...
Homo sapiens
Q3V5L5 0 100.0 Alpha-1,6-manno...
Homo sapiens
EAW89459 0 99.7 mannosyl (alpha...
Homo sapiens
EAW89457 0 99.7 mannosyl (alpha...
Homo sapiens
XP_001106632 0 98.1 similar to beta...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No.
Experimental conditions
Panel name
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp