KIAA2009

Product ID	ORK05971
Accession No	AB095929
Description	mex-3 RNA binding family member B
Clone name	fj05611
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4333 bp) Predicted protein sequence (501 aa)
Source	Human fetal brain
Rouge ID	mKIAA2009 by Kazusa Mouse cDNA Project

Length: 4333 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	1373 bp
Genome contig ID	gi51511731r_80021183
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- TTTTTAAGTATTTCTATATAAATAAAATATTGAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATCTTATCTTGTGTGGTGACTTTTTTTTTAAGCCTCTTGGAATCTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	80121183	80125515	1	99.0	Perfect prediction

Length: 501 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6ZN04	4.1e-150	98.0	RNA-binding pro...	Homo sapiens
AAH36211	2e-149	97.6	MEX3B protein [...	Homo sapiens
XP_523137	3.4e-149	97.6	ring finger and...	Pan troglodytes
CAL38674	3.8e-149	97.4	hypothetical pr...	synthetic construct
CAL37893	3.8e-149	97.4	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB107353	3.2e-24	50.6	KIAA2031

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004088	16	59	PF00013	K Homology
	IPR004088	94	153	PF00013	K Homology
	IPR001841	450	489	PF00097	Zinc finger
HMMSmart	IPR004087	2	64	SM00322	K Homology
	IPR004087	91	158	SM00322	K Homology
	IPR001841	450	489	SM00184	Zinc finger
ProfileScan	IPR004088	92	153	PS50084	K Homology
ProfileScan	IPR001841	450	490	PS50089	Zinc finger

Primer_f	TACATCAAGACCCCAGTTCGC
Primer_r	TGAGTGCCGTGTTCTTATTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-