Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00970 |
---|---|
Accession No | AB095933 |
Description | KIAA2013 |
Clone name | bm04064 |
Vector information | |
cDNA sequence | DNA sequence (2538 bp) Predicted protein sequence (730 aa) |
HaloTag ORF Clone |
FHC00970
|
Flexi ORF Clone | FXC00970 |
Source | Human adult brain |
Rouge ID |
mKIAA2013
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 343 bp |
---|---|
Genome contig ID | gi89161185r_11804999 |
PolyA signal sequence (AATAAA,-9) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99820 - 99771) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 11904819 | 11909072 | 2 | 99.5 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 37 | EARAAGPVGWAAGPAAALAPLP | 58 | SECONDARY | 22 | 2 | 85 | LLCLLGLLLLLLWFGGSGA | 103 | PRIMARY | 19 | 3 | 144 | EVVPLGPGVPALVANGFLALDVA | 166 | SECONDARY | 23 | 4 | 654 | PFLFWFSVASLITLFHLFLFKLI | 676 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | AGGAAATGCTGGAGCTCTTGG |
---|---|
Primer_r | GCAGGAGAGCATGTAATAGAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |