KIAA2035

Product ID	ORK07404
Accession No	AB111887
Description	zinc finger CCCH-type containing 6
Clone name	ff09201
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (10939 bp) Predicted protein sequence (1135 aa)
Source	Human fetal brain
Rouge ID	mKIAA2035 by Kazusa Mouse cDNA Project

Length: 10939 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	7529 bp
Genome contig ID	gi89161199f_112677275
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TCTATTGTCTGAATTTAAATAAAAATGTTTCTAAT
Flanking genome sequence (136832 - 136881)	----+--------+--------+--------+--------+----* AATATCTGTCTGGCAGTGTGATGCTTTGCTTTAATAAATCTTCAGCATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	112774025	112814105	12	99.2	Perfect prediction

Length: 1135 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P61129	100.0	Zinc finger CCC...	Homo sapiens
NP_940983	100.0	zinc finger CCC...	Homo sapiens
XP_525863	98.9	zinc finger CCC...	Pan troglodytes
XP_001087547	98.0	zinc finger CCC...	Macaca mulatta
XP_001495641	89.5	zinc finger CCC...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028987	1.6e-20	34.1	KIAA1064

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000571	219	244	PF00642	Zinc finger
	IPR000571	248	273	PF00642	Zinc finger
	IPR000571	275	297	PF00642	Zinc finger
HMMSmart	IPR000571	219	244	SM00356	Zinc finger
	IPR000571	248	273	SM00356	Zinc finger
	IPR000571	274	297	SM00356	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-