KIAA1904

Product ID	ORK00946
Accession No	AB067491
Description	extracellular leucine-rich repeat and fibronectin type III domain containing 2, transcript variant 1
Clone name	af00058
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7579 bp) Predicted protein sequence (821 aa)
HaloTag ORF Clone	FHC00946
Flexi ORF Clone	FXC00946
Source	Human brain (amygdala)
Rouge ID	mKIAA1904 by Kazusa Mouse cDNA Project

Length: 7579 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5111 bp
Genome contig ID	gi89161203r_35993947
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTCTATATTTGCAATAAATTTCTTATTTAAAGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACGGGGCCATGGTCTATGCTGTATTCCTCCCACATTGCACTGCCATGACG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	36093947	36101525	1	99.0	Perfect prediction

Length: 821 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10177	100.0	leucine-rich re...	synthetic construct
Q5R3F8	99.8	Leucine-rich re...	Homo sapiens
XP_001086834	98.9	similar to slit...	Macaca mulatta
XP_001500931	97.0	extracellular l...	Equus caballus
Q68FM6	95.4	Leucine-rich re...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011537	4.1e-09	26.0	KIAA0813
AB040898	4.1e-09	27.1	KIAA1465
AB011538	1.2e-08	33.3	KIAA0814
AB018349	3.4e-08	31.4	KIAA0806
D86983	1.8e-07	26.9	KIAA0230

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	106	119	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	151	164	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	81	103	PF00560	Leucine-rich repeat
	IPR001611	105	127	PF00560	Leucine-rich repeat
	IPR001611	153	175	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	79	102	SM00369	Leucine-rich repeat
	IPR003591	104	126	SM00369	Leucine-rich repeat
	IPR003591	127	150	SM00369	Leucine-rich repeat
	IPR003591	151	174	SM00369	Leucine-rich repeat
ProfileScan	IPR001899	389	430	PS50847	Surface protein from Gram-positive cocci

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	3	LRLGLCAAALLCVCRPGAVRADC	25	PRIMARY	23
SOSUI2	2	397	HYIMTILGCLFGMVIVLGAVYYC	419	PRIMARY	23

Primer_f	ACGCCTCTACTAGCAGCTTTG
Primer_r	ATGGCACTAGCTTTCCTGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-