Gene/Protein Characteristic Table for KIAA0814
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01606
Accession No AB011538
Description slit guidance ligand 3, transcript variant 2
Clone name fh16048
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5156 bp)
Predicted protein sequence (1559 aa)
Flexi ORF Clone FXC01606
Source Human fetal brain
Rouge ID mKIAA0814 by Kazusa Mouse cDNA Project
Note We replaced hg02635, former representative clones for KIAA0814 with fh16048. (1998/8/22)
Features of the cloned cDNA sequence
Description

Length: 5156 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 164 bp
Genome contig ID gi51511721r_167925873
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
TAAGTATATTGTAAAATAAACAAAAAATAGAACTT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ATTTTTATTATGGAAAGTGACTATTTTCATCTTTTATTATATAAATATAT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 5 r 168025873 168660711 35 100.0 Internal No-hit
Features of the protein sequence
Description

Length: 1559 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAA32466 0 100.0 MEGF5 [Homo sap...
 Homo sapiens
O75094 0 100.0 Slit homolog 3 ...
 Homo sapiens
AAQ89243 0 99.9 SLIT3 [Homo sap...
 Homo sapiens
O88280 0 93.9 Slit homolog 3 ...
 Rattus norvegicus
CAI25608 0 94.0 slit homolog 3 ...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB011537 0 59.0 KIAA0813
D87469 1.3e-15 26.9 KIAA0279
D86983 1.6e-13 34.5 KIAA0230
AB011539 3.4e-13 25.8 KIAA0815
AB067497 9.4e-13 23.6 KIAA1910
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001611 171 184 PR00019 Leucine-rich repeat
IPR001611 592 605 PR00019 Leucine-rich repeat
HMMPfam IPR000372 69 96 PF01462 Leucine-rich repeat
IPR001611 98 120 PF00560 Leucine-rich repeat
IPR001611 122 144 PF00560 Leucine-rich repeat
IPR001611 146 168 PF00560 Leucine-rich repeat
IPR001611 170 192 PF00560 Leucine-rich repeat
IPR001611 194 216 PF00560 Leucine-rich repeat
IPR001611 218 240 PF00560 Leucine-rich repeat
IPR000483 275 300 PF01463 Cysteine-rich flanking region
IPR000372 315 342 PF01462 Leucine-rich repeat
IPR001611 368 390 PF00560 Leucine-rich repeat
IPR001611 392 414 PF00560 Leucine-rich repeat
IPR001611 440 462 PF00560 Leucine-rich repeat
IPR000483 497 522 PF01463 Cysteine-rich flanking region
IPR000372 540 567 PF01462 Leucine-rich repeat
IPR001611 594 616 PF00560 Leucine-rich repeat
IPR001611 618 640 PF00560 Leucine-rich repeat
IPR001611 642 664 PF00560 Leucine-rich repeat
IPR001611 666 688 PF00560 Leucine-rich repeat
IPR000483 723 748 PF01463 Cysteine-rich flanking region
IPR000372 760 787 PF01462 Leucine-rich repeat
IPR001611 789 810 PF00560 Leucine-rich repeat
IPR001611 812 834 PF00560 Leucine-rich repeat
IPR001611 836 858 PF00560 Leucine-rich repeat
IPR001611 860 882 PF00560 Leucine-rich repeat
IPR000483 917 942 PF01463 Cysteine-rich flanking region
IPR006209 956 988 PF00008 EGF-like
IPR006209 995 1029 PF00008 EGF-like
IPR006209 1036 1067 PF00008 EGF-like
IPR006209 1074 1107 PF00008 EGF-like
IPR006209 1114 1145 PF00008 EGF-like
IPR006209 1159 1190 PF00008 EGF-like
IPR012680 1222 1350 PF02210 Laminin G
IPR006209 1368 1400 PF00008 EGF-like
IPR006209 1408 1438 PF00008 EGF-like
IPR006209 1448 1479 PF00008 EGF-like
HMMSmart IPR000372 69 101 SM00013 Leucine-rich repeat
IPR003591 95 119 SM00369 Leucine-rich repeat
IPR003591 120 143 SM00369 Leucine-rich repeat
NULL 120 141 SM00365 NULL
NULL 144 163 SM00364 NULL
IPR003591 144 167 SM00369 Leucine-rich repeat
NULL 144 165 SM00365 NULL
NULL 168 194 SM00365 NULL
IPR003591 168 191 SM00369 Leucine-rich repeat
NULL 168 187 SM00364 NULL
IPR003591 192 215 SM00369 Leucine-rich repeat
IPR003591 216 239 SM00369 Leucine-rich repeat
IPR003590 240 268 SM00368 Leucine-rich repeat
IPR000483 251 300 SM00082 Cysteine-rich flanking region
IPR000372 315 347 SM00013 Leucine-rich repeat
IPR003591 341 365 SM00369 Leucine-rich repeat
NULL 366 387 SM00365 NULL
IPR003591 366 389 SM00369 Leucine-rich repeat
IPR003591 390 413 SM00369 Leucine-rich repeat
IPR003590 390 416 SM00368 Leucine-rich repeat
NULL 390 412 SM00365 NULL
IPR003591 414 437 SM00369 Leucine-rich repeat
IPR003591 438 461 SM00369 Leucine-rich repeat
NULL 438 460 SM00365 NULL
IPR003590 462 490 SM00368 Leucine-rich repeat
IPR000483 473 522 SM00082 Cysteine-rich flanking region
IPR000372 540 572 SM00013 Leucine-rich repeat
IPR003590 592 625 SM00368 Leucine-rich repeat
NULL 592 611 SM00364 NULL
IPR003591 592 615 SM00369 Leucine-rich repeat
IPR003591 617 639 SM00369 Leucine-rich repeat
IPR003591 640 663 SM00369 Leucine-rich repeat
NULL 640 661 SM00365 NULL
IPR003591 664 687 SM00369 Leucine-rich repeat
NULL 664 685 SM00365 NULL
IPR000483 699 748 SM00082 Cysteine-rich flanking region
IPR000372 760 792 SM00013 Leucine-rich repeat
NULL 787 806 SM00364 NULL
NULL 810 836 SM00365 NULL
IPR003591 810 833 SM00369 Leucine-rich repeat
IPR003590 834 860 SM00368 Leucine-rich repeat
NULL 834 853 SM00364 NULL
IPR003591 834 857 SM00369 Leucine-rich repeat
IPR003591 858 881 SM00369 Leucine-rich repeat
IPR003590 882 910 SM00368 Leucine-rich repeat
IPR000483 893 942 SM00082 Cysteine-rich flanking region
IPR001881 952 989 SM00179 EGF-like calcium-binding
IPR006210 955 989 SM00181 EGF
IPR001881 991 1030 SM00179 EGF-like calcium-binding
IPR006210 994 1030 SM00181 EGF
IPR001881 1032 1068 SM00179 EGF-like calcium-binding
IPR006210 1035 1068 SM00181 EGF
IPR001881 1071 1108 SM00179 EGF-like calcium-binding
IPR006210 1073 1108 SM00181 EGF
IPR001881 1110 1146 SM00179 EGF-like calcium-binding
IPR006210 1113 1146 SM00181 EGF
IPR006210 1158 1191 SM00181 EGF
IPR001881 1159 1191 SM00179 EGF-like calcium-binding
IPR001791 1214 1350 SM00282 Laminin G
IPR006210 1367 1401 SM00181 EGF
IPR001881 1371 1401 SM00179 EGF-like calcium-binding
IPR001881 1404 1439 SM00179 EGF-like calcium-binding
IPR006210 1407 1439 SM00181 EGF
IPR001881 1440 1480 SM00179 EGF-like calcium-binding
IPR006210 1447 1480 SM00181 EGF
IPR006207 1491 1559 SM00041 Cystine knot
ProfileScan IPR000742 954 989 PS50026 EGF-like
IPR000742 991 1030 PS50026 EGF-like
IPR000742 1032 1068 PS50026 EGF-like
IPR000742 1070 1108 PS50026 EGF-like
IPR000742 1110 1146 PS50026 EGF-like
IPR000742 1155 1191 PS50026 EGF-like
IPR001791 1194 1368 PS50025 Laminin G
IPR000742 1376 1401 PS50026 EGF-like
IPR000742 1404 1439 PS50026 EGF-like
IPR000742 1444 1480 PS50026 EGF-like
IPR006207 1485 1559 PS01225 Cystine knot
ScanRegExp IPR013032 977 988 PS00022 EGF-like region
IPR013032 1018 1029 PS00022 EGF-like region
IPR013032 1018 1029 PS01186 EGF-like region
IPR001881 1032 1056 PS01187 EGF-like calcium-binding
IPR000152 1047 1058 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1056 1067 PS00022 EGF-like region
IPR013032 1096 1107 PS00022 EGF-like region
IPR013032 1096 1107 PS01186 EGF-like region
IPR001881 1110 1134 PS01187 EGF-like calcium-binding
IPR000152 1125 1136 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1134 1145 PS00022 EGF-like region
IPR013032 1134 1145 PS01186 EGF-like region
IPR013032 1179 1190 PS00022 EGF-like region
IPR013032 1179 1190 PS01186 EGF-like region
IPR013032 1389 1400 PS00022 EGF-like region
IPR013032 1389 1400 PS01186 EGF-like region
IPR013032 1427 1438 PS00022 EGF-like region
IPR013032 1427 1438 PS01186 EGF-like region
IPR013032 1468 1479 PS00022 EGF-like region
IPR013032 1468 1479 PS01186 EGF-like region
IPR006207 1522 1558 PS01185 Cystine knot
Experimental conditions
Primer_f TCTAACCTTTCCCTTCACCAG
Primer_r GTAATGCCCTATGACTCCTCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name GeneBridge 4
Primer_f TCTAACCTTTCCCTTCACCAG
Primer_r GTAATGCCCTATGACTCCTCC
PCR product length 165 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp