KIAA1409

Product ID	ORK05659
Accession No	AB037830
Description	unc-79 homolog (C. elegans)
Clone name	af00533
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7816 bp) Predicted protein sequence (2461 aa)
Source	Human brain (amygdala)
Note	We replaced fh04461, former representative clones for KIAA1409 with af00533. (2005/08/06)

Length: 7816 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	430 bp
Genome contig ID	gi51511730f_92923762
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACTCTTGGCAATGCAATAAAAAAAACCGTCACCAT
Flanking genome sequence (319673 - 319722)	----+--------+--------+--------+--------+----* AAGCCAGTGACACCTGACTGAAGCTTTTTGTCTTTATCCTGGGAAAAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	93013797	93243433	48	99.8	Perfect prediction

Length: 2461 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001094916	99.1	similar to CG52...	Macaca mulatta
NP_065869	99.0	hypothetical pr...	Homo sapiens
XP_001095032	98.2	similar to CG52...	Macaca mulatta
XP_001150811	98.3	hypothetical pr...	Pan troglodytes
NP_001074486	94.5	hypothetical pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TATTTCTGATGACTCCTTGGG
Primer_r	CAACAGGGGGACTTATACAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 14

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTGAGCTGGGAGTTCTTTGTC
Primer_r	CAACATTGGTCCTCACAGCAG
PCR product length	121 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles