Gene/Protein Characteristic Table for KIAA2003
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00968
Accession No AB095924
Description zinc finger protein 154, transcript variant 1
Clone name ah02593
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5687 bp)
Predicted protein sequence (460 aa)
Flexi ORF Clone FXC00968
Source Human brain (amygdala)
Features of the cloned cDNA sequence
Description

Length: 5687 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 4176 bp
Genome contig ID gi42406306r_62800946
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTGAGTCATTTTTTAATTAGAATTTGCTGTATTCT
Flanking genome sequence
(99601 - 99552)
----+----*----+----*----+----*----+----*----+----*
AGATGTGGCTTATTGAATCTCTAACATTGTTTAACTTGTACACTAGATGT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 r 62900547 62912348 4 99.1 Perfect prediction
Features of the protein sequence
Description

Length: 460 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI52427 7.4e-194 100.0 ZNF154 protein ...
Homo sapiens
Q13106 2.1e-193 99.8 Zinc finger pro...
Homo sapiens
BAC03839 1.5e-192 99.3 unnamed protein...
Homo sapiens
XP_548583 4.2e-130 77.0 similar to zinc...
Canis lupus fam...
XP_853657 1e-127 76.0 similar to zinc...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051497 5.1e-67 49.0 KIAA1710
AB075836 8.1e-65 53.1 KIAA1956
AB075827 1.2e-64 52.3 KIAA1947
AB040941 8.5e-62 54.9 KIAA1508
AB002324 8.3e-59 52.9 KIAA0326
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 184 207 PD000003 Zinc finger
IPR007087 212 235 PD000003 Zinc finger
IPR007087 240 263 PD000003 Zinc finger
IPR007087 268 291 PD000003 Zinc finger
IPR007087 296 318 PD000003 Zinc finger
IPR007087 324 347 PD000003 Zinc finger
IPR007087 352 375 PD000003 Zinc finger
IPR007087 380 403 PD000003 Zinc finger
IPR007087 408 431 PD000003 Zinc finger
IPR007087 436 459 PD000003 Zinc finger
HMMPfam IPR001909 37 77 PF01352 KRAB box
IPR007087 184 206 PF00096 Zinc finger
IPR007087 212 234 PF00096 Zinc finger
IPR007087 240 262 PF00096 Zinc finger
IPR007087 268 290 PF00096 Zinc finger
IPR007087 296 318 PF00096 Zinc finger
IPR007087 324 346 PF00096 Zinc finger
IPR007087 352 374 PF00096 Zinc finger
IPR007087 380 402 PF00096 Zinc finger
IPR007087 408 430 PF00096 Zinc finger
IPR007087 436 458 PF00096 Zinc finger
HMMSmart IPR001909 37 102 SM00349 KRAB box
IPR015880 184 206 SM00355 Zinc finger
IPR015880 212 234 SM00355 Zinc finger
IPR015880 240 262 SM00355 Zinc finger
IPR015880 268 290 SM00355 Zinc finger
IPR015880 296 318 SM00355 Zinc finger
IPR015880 324 346 SM00355 Zinc finger
IPR015880 352 374 SM00355 Zinc finger
IPR015880 380 402 SM00355 Zinc finger
IPR015880 408 430 SM00355 Zinc finger
IPR015880 436 458 SM00355 Zinc finger
ProfileScan IPR001909 37 111 PS50805 KRAB box
IPR007087 184 211 PS50157 Zinc finger
IPR007087 212 239 PS50157 Zinc finger
IPR007087 240 267 PS50157 Zinc finger
IPR007087 268 295 PS50157 Zinc finger
IPR007087 296 323 PS50157 Zinc finger
IPR007087 324 351 PS50157 Zinc finger
IPR007087 352 379 PS50157 Zinc finger
IPR007087 380 407 PS50157 Zinc finger
IPR007087 408 435 PS50157 Zinc finger
IPR007087 436 460 PS50157 Zinc finger
ScanRegExp IPR007087 186 206 PS00028 Zinc finger
IPR007087 214 234 PS00028 Zinc finger
IPR007087 242 262 PS00028 Zinc finger
IPR007087 270 290 PS00028 Zinc finger
IPR007087 298 318 PS00028 Zinc finger
IPR007087 326 346 PS00028 Zinc finger
IPR007087 354 374 PS00028 Zinc finger
IPR007087 382 402 PS00028 Zinc finger
IPR007087 410 430 PS00028 Zinc finger
IPR007087 438 458 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TCAGAAGCAATGTGGGCAGAG
Primer_r AGTGTGAGCAGCCTGTTGATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp