KIAA1908

Gene/Protein Characteristic Table for KIAA1908

Order Kazusa clone(s) from :

Product ID	ORK07538
Accession No	AB067495
Description	KIAA1908
Clone name	ah02604
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5676 bp) Predicted protein sequence (445 aa)
Source	Human brain (amygdala)

Features of the cloned cDNA sequence

Description

Length: 5676 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1352 bp
Genome contig ID	gi89161213f_1476257
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTTTCATCATCTGCAATAAAAACTCTGTATGCATT
Flanking genome sequence (119530 - 119579)	----+--------+--------+--------+--------+----* AAACCATAACTCTCCATCCTTCTGCCCCTCTTGCCGCTGGTACCCACCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	1576257	1595785	4	99.1	Perfect prediction

Features of the protein sequence

Description

Length: 445 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC03573	3.6e-88	100.0	unnamed protein...	Homo sapiens
BAC03830	1.3e-56	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AGATTCTGAAGCTTGGCGGAG
Primer_r	TATCCGAGTTCCTGCCATTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 7

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp