KIAA1882

Gene/Protein Characteristic Table for KIAA1882

Order Kazusa clone(s) from :

Product ID	ORK00940
Accession No	AB067469
Description	trafficking protein particle complex 9, transcript variant 2
Clone name	aj00515
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4247 bp) Predicted protein sequence (1176 aa)
HaloTag ORF Clone	FHC00940
Flexi ORF Clone	FXC00940
Source	Human brain (amygdala)
Rouge ID	mKIAA1882 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4247 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	716 bp
Genome contig ID	gi51511724r_140711770
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GCAAGCAGTTCTTCAATAAATGGCCTGCCTCCCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCCTGCCTCCCTGCATCTGCTAGCCCAGTGCAGTCCGGGGCCCCCACCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	140811770	141536993	23	99.7	Perfect prediction

Features of the protein sequence

Description

Length: 1176 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC87600	97.6	unnamed protein...	Homo sapiens
Q96Q05	100.0	Trafficking pro...	Homo sapiens
XP_001142596	97.3	hypothetical pr...	Pan troglodytes
XP_539179	95.1	similar to NIK ...	Canis lupus fam...
Q3U0M1	92.7	Trafficking pro...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CAACAAAGCAGGCGACTACAG
Primer_r	TGACTCGGGTGAAAAATACAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 8

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp