KIAA1862

Product ID	ORK00936
Accession No	AB058765
Description	KRAB-A domain containing 1, transcript variant 1
Clone name	aj00563
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4018 bp) Predicted protein sequence (1070 aa)
HaloTag ORF Clone	FHC00936
Flexi ORF Clone	FXC00936
Source	Human brain (amygdala)
Rouge ID	mKIAA1862 by Kazusa Mouse cDNA Project
Note	We replaced fh24543, former representative clones for KIAA1862 with aj00563. (2002/5/10)

Length: 4018 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	526 bp
Genome contig ID	gi89161213f_148943081
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GTGGATTCTGAAATTAAAGAAGTGAGTTGCTAAGG
Flanking genome sequence (119516 - 119565)	----+--------+--------+--------+--------+----* AAGGCCCTGACTCCTATAGAAGGGAGGTCCATGTGGGCCCACGCTGGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	149043081	149062595	17	99.9	Perfect prediction

Length: 1070 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_115923	0	99.9	KRAB A domain c...	Homo sapiens
AAI42723	0	99.9	KRBA1 protein [...	Homo sapiens
AAH33229	2.1e-135	91.6	KRBA1 protein [...	Homo sapiens
XP_590551	9.5e-62	57.1	similar to RIKE...	Bos taurus
EDK98525	2.6e-48	53.5	RIKEN cDNA A930...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001909	12	52	PF01352	KRAB box
HMMSmart	IPR001909	12	74	SM00349	KRAB box
ProfileScan	IPR001909	12	90	PS50805	KRAB box

Primer_f	CCTTCCTGGAGTAAATATTGG
Primer_r	ACATGGACCTCCCTTCTATAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-