Gene/Protein Characteristic Table for FLJ00005
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04324
Accession No AK000005
Clone name as00005
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4706 bp)
Predicted protein sequence (111 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4706 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 111 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAA92230 3.5e-37 100.0 FLJ00005 protei...
Homo sapiens
EAW99294 5.5e-32 100.0 chromosome 15 o...
Homo sapiens
EAW99292 6e-32 100.0 chromosome 15 o...
Homo sapiens
EAW99289 6.3e-32 100.0 chromosome 15 o...
Homo sapiens
EAW99293 7.4e-32 100.0 chromosome 15 o...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TACTCTGTTCTGGAATGGGAC
Primer_r ACAAGAAAGGCCTGGACATGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp