Order Kazusa clone(s) from : ![]() |
Product ID | ORK05010 |
---|---|
Accession No | AK000007 |
Clone name | as00007 |
Vector information | |
cDNA sequence | DNA sequence (4303 bp) Predicted protein sequence (701 aa) |
HaloTag ORF Clone |
FHC05010
![]() |
Flexi ORF Clone | FXC05010 |
Source | Human spleen |
Rouge ID |
mFLJ00007
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 486 | 535 | PD000066 | SH3 |
IPR001452 | 563 | 610 | PD000066 | SH3 | |
FPrintScan | IPR001452 | 560 | 570 | PR00452 | SH3 |
IPR001452 | 574 | 589 | PR00452 | SH3 | |
IPR001452 | 606 | 618 | PR00452 | SH3 | |
HMMPfam | IPR001060 | 27 | 118 | PF00611 | Cdc15/Fes/CIP4 |
IPR001452 | 482 | 538 | PF00018 | SH3 | |
NULL | 483 | 537 | PF07653 | NULL | |
IPR001452 | 560 | 618 | PF00018 | SH3 | |
NULL | 561 | 618 | PF07653 | NULL | |
HMMSmart | IPR001060 | 27 | 118 | SM00055 | Cdc15/Fes/CIP4 |
IPR001452 | 482 | 539 | SM00326 | SH3 | |
IPR001452 | 560 | 619 | SM00326 | SH3 | |
ProfileScan | IPR001060 | 23 | 86 | PS50133 | Cdc15/Fes/CIP4 |
IPR001452 | 486 | 540 | PS50002 | SH3 | |
IPR001452 | 557 | 620 | PS50002 | SH3 | |
IPR000694 | 621 | 699 | PS50099 | Proline-rich region |
![]() |
Primer_f | AAGGTCTCTAGTAGTTCTGGC |
---|---|
Primer_r | TCGTGCCCTTTATTCATTGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |