Gene/Protein Characteristic Table for FLJ00007
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05010
Accession No AK000007
Clone name as00007
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4303 bp)
Predicted protein sequence (701 aa)
Flexi ORF Clone FXC05010
Source Human spleen
Rouge ID mFLJ00007 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4303 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 701 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAA92232 3.8e-216 100.0 FLJ00007 protei...
Homo sapiens
Q86WN1 7.5e-213 100.0 FCH and double ...
Homo sapiens
EAW61910 6.9e-212 99.3 FCH and double ...
Homo sapiens
XP_873649 3.4e-196 92.9 similar to FCH ...
Bos taurus
EDL10101 7.6e-193 91.3 FCH and double ...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB018312 2e-25 38.5 KIAA0769
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001452 486 535 PD000066 SH3
IPR001452 563 610 PD000066 SH3
FPrintScan IPR001452 560 570 PR00452 SH3
IPR001452 574 589 PR00452 SH3
IPR001452 606 618 PR00452 SH3
HMMPfam IPR001060 27 118 PF00611 Cdc15/Fes/CIP4
IPR001452 482 538 PF00018 SH3
NULL 483 537 PF07653 NULL
IPR001452 560 618 PF00018 SH3
NULL 561 618 PF07653 NULL
HMMSmart IPR001060 27 118 SM00055 Cdc15/Fes/CIP4
IPR001452 482 539 SM00326 SH3
IPR001452 560 619 SM00326 SH3
ProfileScan IPR001060 23 86 PS50133 Cdc15/Fes/CIP4
IPR001452 486 540 PS50002 SH3
IPR001452 557 620 PS50002 SH3
IPR000694 621 699 PS50099 Proline-rich region
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AAGGTCTCTAGTAGTTCTGGC
Primer_r TCGTGCCCTTTATTCATTGTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp