Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00630 |
---|---|
Accession No | AB018312 |
Description | FCH and double SH3 domains 2 |
Clone name | hk05035 |
Vector information | |
cDNA sequence | DNA sequence (4341 bp) Predicted protein sequence (746 aa) |
HaloTag ORF Clone |
FHC00630
|
Flexi ORF Clone | FXC00630 |
Source | Human adult brain |
Rouge ID |
mKIAA0769
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 479 | 532 | PD000066 | Src homology-3 |
IPR001452 | 578 | 631 | PD000066 | Src homology-3 | |
FPrintScan | IPR001452 | 576 | 586 | PR00452 | Src homology-3 |
IPR001452 | 590 | 605 | PR00452 | Src homology-3 | |
IPR001452 | 621 | 633 | PR00452 | Src homology-3 | |
HMMPfam | IPR001060 | 46 | 114 | PF00611 | Cdc15/Fes/CIP4 |
IPR001452 | 478 | 532 | PF00018 | Src homology-3 | |
IPR001452 | 576 | 633 | PF00018 | Src homology-3 | |
HMMSmart | IPR001452 | 478 | 535 | SM00326 | Src homology-3 |
IPR001452 | 576 | 634 | SM00326 | Src homology-3 | |
ProfileScan | IPR001452 | 475 | 536 | PS50002 | Src homology-3 |
IPR001452 | 573 | 635 | PS50002 | Src homology-3 |
RT-PCR-ELISA |
Primer_f | GATAAGTTGAGGACACATACC |
---|---|
Primer_r | ACGGAAATGTCAGGGTAGTGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |