Gene/Protein Characteristic Table for KIAA0769
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00630
Accession No AB018312
Description FCH and double SH3 domains 2
Clone name hk05035
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4341 bp)
Predicted protein sequence (746 aa)
Flexi ORF Clone FXC00630
Source Human adult brain
Rouge ID mKIAA0769 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4341 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 746 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001110150 0 98.7 similar to FCH ...
Macaca mulatta
XP_001174757 0 100.0 FCH and double ...
Pan troglodytes
O94868 0 100.0 FCH and double ...
Homo sapiens
EAW74880 0 100.0 FCH and double ...
Homo sapiens
Q3USJ8 0 96.6 FCH and double ...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001452 479 532 PD000066 Src homology-3
IPR001452 578 631 PD000066 Src homology-3
FPrintScan IPR001452 576 586 PR00452 Src homology-3
IPR001452 590 605 PR00452 Src homology-3
IPR001452 621 633 PR00452 Src homology-3
HMMPfam IPR001060 46 114 PF00611 Cdc15/Fes/CIP4
IPR001452 478 532 PF00018 Src homology-3
IPR001452 576 633 PF00018 Src homology-3
HMMSmart IPR001452 478 535 SM00326 Src homology-3
IPR001452 576 634 SM00326 Src homology-3
ProfileScan IPR001452 475 536 PS50002 Src homology-3
IPR001452 573 635 PS50002 Src homology-3
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GATAAGTTGAGGACACATACC
Primer_r ACGGAAATGTCAGGGTAGTGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp