Gene/Protein Characteristic Table for FLJ00008
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05032
Accession No AK024419
Clone name as00008
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4553 bp)
Predicted protein sequence (217 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4553 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 217 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15709 3.7e-82 100.0 FLJ00008 protei...
Homo sapiens
XP_001157870 3.9e-75 96.2 similar to FAM1...
Pan troglodytes
NP_001073891 6.2e-74 93.5 hypothetical pr...
Homo sapiens
EAX02943 4.1e-65 86.2 hCG1999863 [Hom...
Homo sapiens
EAW69447 2.7e-63 100.0 family with seq...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AK074043 2e-55 100.0 FLJ00099
AK090438 2e-55 100.0 FLJ00358
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CTCCTGCATGTATGTTCGCTG
Primer_r GAGTAGTCGTAGGAGAAGATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp