Gene/Protein Characteristic Table for FLJ00011
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06324
Accession No AK024422
Clone name as00011
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4306 bp)
Predicted protein sequence (394 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4306 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 394 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15712 5.7e-115 100.0 FLJ00011 protei...
Homo sapiens
XP_507988 2.2e-111 97.0 similar to FLJ0...
Pan troglodytes
XP_001718129 1.4e-104 100.0 similar to FLJ0...
Homo sapiens
EAW49789 3.4e-61 99.6 hCG1647209 [Hom...
Homo sapiens
AAI72054 1.2e-53 67.4 Unknown (protei...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001478 223 309 PF00595 PDZ/DHR/GLGF domain
HMMSmart IPR001478 231 312 SM00228 PDZ/DHR/GLGF domain
ProfileScan IPR000694 63 186 PS50099 Proline-rich region
IPR001478 223 295 PS50106 PDZ/DHR/GLGF domain
IPR000694 311 394 PS50099 Proline-rich region
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CTACCAACTTCTTCAGGACTC
Primer_r TTGGCTTTCTCACCCCCTATC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp