Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06324 |
---|---|
Accession No | AK024422 |
Clone name | as00011 |
Vector information | |
cDNA sequence | DNA sequence (4306 bp) Predicted protein sequence (394 aa) |
Source | Human spleen |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001478 | 223 | 309 | PF00595 | PDZ/DHR/GLGF domain |
HMMSmart | IPR001478 | 231 | 312 | SM00228 | PDZ/DHR/GLGF domain |
ProfileScan | IPR000694 | 63 | 186 | PS50099 | Proline-rich region |
IPR001478 | 223 | 295 | PS50106 | PDZ/DHR/GLGF domain | |
IPR000694 | 311 | 394 | PS50099 | Proline-rich region |
RT-PCR-ELISA |
Primer_f | CTACCAACTTCTTCAGGACTC |
---|---|
Primer_r | TTGGCTTTCTCACCCCCTATC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |