Gene/Protein Characteristic Table for FLJ00013
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05035
Accession No AK024424
Clone name as00013
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4896 bp)
Predicted protein sequence (75 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4896 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 75 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15714 1.4e-31 100.0 FLJ00013 protei...
Homo sapiens
XP_001149365 8.1e-23 95.3 acyl-CoA synthe...
Pan troglodytes
BAC03853 2.1e-16 90.4 unnamed protein...
Homo sapiens
AAI14613 2.2e-16 90.4 ACSS1 protein [...
Homo sapiens
XP_001149649 2.4e-16 90.4 acyl-CoA synthe...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB058749 4.3e-20 90.4 KIAA1846
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GGCGTCTTGTGATGTCTTGCA
Primer_r CTCAACGGATTAAATGTCATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp