Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07228 |
---|---|
Accession No | AK024427 |
Clone name | as00016 |
Vector information | |
cDNA sequence | DNA sequence (4445 bp) Predicted protein sequence (349 aa) |
Source | Human spleen |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ProfileScan | IPR000301 | 172 | 286 | PS50257 | CD9/CD37/CD63 antigen |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 252 | QDNLIVVAGVFMGIALLQIFGIC | 274 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TCCTGCTCAAGTTTTTCTCCG |
---|---|
Primer_r | GTCAATGAGGTTCTGGAGGTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |