FLJ00017

Gene/Protein Characteristic Table for FLJ00017

Order Kazusa clone(s) from :

Product ID	ORK06504
Accession No	AK024428
Clone name	as00017
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4459 bp) Predicted protein sequence (291 aa)
Source	Human spleen
Rouge ID	mFLJ00017 by Kazusa Mouse cDNA Project

Length: 4459 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Features of the protein sequence

Description

Length: 291 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15718	1.2e-129	100.0	FLJ00017 protei...	Homo sapiens
EAW60154	3.4e-123	100.0	pleckstrin homo...	Homo sapiens
Q9UIA0	7.2e-100	100.0	Cytohesin-4; PH...	Homo sapiens
BAG37529	7.2e-100	100.0	unnamed protein...	Homo sapiens
XP_001086587	2.6e-99	98.7	pleckstrin homo...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018306	9.7e-24	37.0	KIAA0763
AB011094	1.7e-22	38.0	KIAA0522
AB029033	4.7e-22	39.6	KIAA1110
D87435	7.7e-21	38.4	KIAA0248
AB095931	1.1e-12	29.6	KIAA2011

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000904	70	265	PF01369	SEC7-like domain
HMMSmart	IPR000904	71	265	SM00222	SEC7-like domain
ProfileScan	IPR000904	67	254	PS50190	SEC7-like domain

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AGAAGCTGAAGGATGAGATTG
Primer_r	TGAAATACTGGATACCCTTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp