Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06504 |
---|---|
Accession No | AK024428 |
Clone name | as00017 |
Vector information | |
cDNA sequence | DNA sequence (4459 bp) Predicted protein sequence (291 aa) |
Source | Human spleen |
Rouge ID |
mFLJ00017
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RT-PCR-ELISA |
Primer_f | AGAAGCTGAAGGATGAGATTG |
---|---|
Primer_r | TGAAATACTGGATACCCTTGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |