Gene/Protein Characteristic Table for FLJ00023
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06040
Accession No AK024433
Clone name as00023
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4503 bp)
Predicted protein sequence (192 aa)
Source Human spleen
Rouge ID mFLJ00023 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4503 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 192 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15723 1.4e-76 100.0 FLJ00023 protei...
Homo sapiens
XP_001091560 1e-70 95.7 similar to Mito...
Macaca mulatta
P82663 3.5e-69 100.0 28S ribosomal p...
Homo sapiens
XP_001491213 5.6e-65 92.5 similar to Mito...
Equus caballus
XP_533729 9.4e-65 87.1 similar to Mito...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007741 39 129 PF05047 Mitochondrial ribosome
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGTCTTGACCTTGATACCACC
Primer_r GGGAAGGAATACTCTCATAAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp