Gene/Protein Characteristic Table for FLJ00033
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05042
Accession No AK024443
Clone name as00033
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4150 bp)
Predicted protein sequence (253 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4150 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 253 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15733 2.3e-113 100.0 FLJ00033 protei...
Homo sapiens
BAC56931 3.4e-100 97.0 FLJ00415 protei...
Homo sapiens
BAG54465 3.7e-100 97.0 unnamed protein...
Homo sapiens
CAH56322 4.3e-100 97.0 hypothetical pr...
Homo sapiens
AAH25663 4.5e-100 97.0 PNPLA7 protein ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AK122590 1.2e-104 97.0 FLJ00415
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002641 1 79 PF01734 Patatin
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AACATGGCAGAGATTCAGACG
Primer_r TCGCAGATCTCGTTGAACTTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp