Gene/Protein Characteristic Table for FLJ00034
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK03385
Accession No AK024444
Clone name as00034
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4305 bp)
Predicted protein sequence (1343 aa)
Flexi ORF Clone FXC03385
Source Human spleen
Rouge ID mFLJ00034 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4305 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1343 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15734 0 100.0 FLJ00034 protei...
Homo sapiens
Q9H7N4 0 100.0 Splicing factor...
Homo sapiens
AAF87552 0 99.9 ser/arg-rich pr...
Homo sapiens
XP_001253211 3.6e-159 93.1 similar to FLJ0...
Bos taurus
XP_541491 8.7e-151 78.4 similar to seri...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB040975 3.9e-06 25.3 KIAA1542
AB002322 0.00036 24.8 KIAA0324
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR003993 919 937 PR01503 Treacher Collins syndrome protein Treacle
IPR003993 1053 1066 PR01503 Treacher Collins syndrome protein Treacle
ProfileScan IPR000694 215 298 PS50099 Proline-rich region
NULL 222 238 PS50324 NULL
NULL 299 319 PS50313 NULL
IPR000694 411 472 PS50099 Proline-rich region
NULL 565 859 PS50324 NULL
NULL 587 685 PS50323 NULL
IPR001472 624 641 PS50079 Bipartite nuclear localization signal
NULL 927 957 PS50318 NULL
NULL 1040 1070 PS50313 NULL
IPR000694 1315 1342 PS50099 Proline-rich region
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TATCTGAAGAAGCTGCACACG
Primer_r TTGATTTCCCCACTTTTGCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp