Gene/Protein Characteristic Table for FLJ00042
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05045
Accession No AK024450
Clone name as00042
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4361 bp)
Predicted protein sequence (452 aa)
Source Human spleen
Rouge ID mFLJ00042 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4361 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 452 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15740 1.2e-180 100.0 FLJ00042 protei...
Homo sapiens
EAW85765 1.3e-180 100.0 ras homolog gen...
Homo sapiens
BAC03407 5.7e-86 96.2 FLJ00342 protei...
Homo sapiens
AAK61240 9.4e-54 99.4 similar to AK00...
Homo sapiens
Q8IXI1 9.4e-54 99.4 Mitochondrial R...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AK090426 2.8e-60 96.2 FLJ00342
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGGCTTTGCTTTTCAGATTCG
Primer_r GATGTTCCTCAGGTTCTTGGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp