Gene/Protein Characteristic Table for FLJ00052
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK03386
Accession No AK024460
Clone name as00052
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4394 bp)
Predicted protein sequence (368 aa)
Flexi ORF Clone FXC03386
Source Human spleen
Rouge ID mFLJ00052 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4394 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 368 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15750 3.7e-109 100.0 FLJ00052 protei...
Homo sapiens
XP_509415 4e-109 100.0 similar to FLJ0...
Pan troglodytes
XP_001084823 1e-107 99.2 similar to Sin3...
Macaca mulatta
XP_001924353 2.9e-100 94.8 similar to Sin3...
Sus scrofa
XP_001914936 5.4e-99 94.5 similar to Sin3...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CAGGGTGTTTTCATTCATGCG
Primer_r TGAACACAGGGTCTTATACAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp