Gene/Protein Characteristic Table for FLJ00053
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05051
Accession No AK024461
Clone name as00053
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4484 bp)
Predicted protein sequence (443 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4484 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 443 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15751 2.9e-158 100.0 FLJ00053 protei...
Homo sapiens
EAW87256 6.6e-151 100.0 chromosome 7 op...
Homo sapiens
BAC85133 8e-139 98.5 FLJ00283 protei...
Homo sapiens
EAW87255 4.6e-47 100.0 chromosome 7 op...
Homo sapiens
EAW87259 4.8e-47 100.0 chromosome 7 op...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AK131083 7.7e-85 98.5 FLJ00283
AK131097 1.1e-19 61.3 FLJ00321
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TTCTCCCGTGTTCAGTTCTTC
Primer_r GAATGAAATGCACCCCAGACC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp