Gene/Protein Characteristic Table for FLJ00061
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06130
Accession No AK024468
Clone name as00061
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4621 bp)
Predicted protein sequence (173 aa)
Source Human spleen
Rouge ID mFLJ00061 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4621 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 173 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15758 1.3e-76 100.0 FLJ00061 protei...
Homo sapiens
EAW51781 3e-76 100.0 NECAP endocytos...
Homo sapiens
BAG62429 6.2e-72 100.0 unnamed protein...
Homo sapiens
Q9NVZ3 1.9e-71 100.0 Adaptin ear-bin...
Homo sapiens
XP_513068 1.9e-71 100.0 hypothetical pr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGGCAGTAAATTGGCACCGTG
Primer_r ATCCTGGCAGCAAACTCAACC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp