Gene/Protein Characteristic Table for FLJ00066
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05059
Accession No AK024473
Clone name as00066
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4659 bp)
Predicted protein sequence (162 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4659 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 162 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15763 8.3e-60 100.0 FLJ00066 protei...
Homo sapiens
EAW85123 1.9e-40 95.9 hCG1787598 [Hom...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CCACCACTCATTCACTGTCAG
Primer_r CACTCCGGGAAATTAATGGTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp