Gene/Protein Characteristic Table for FLJ00067
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07287
Accession No AK024474
Clone name as00067
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4394 bp)
Predicted protein sequence (574 aa)
Source Human spleen
Rouge ID mFLJ00067 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4394 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 574 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15764 1.3e-215 100.0 FLJ00067 protei...
Homo sapiens
EAW89324 3.1e-199 100.0 unc-13 homolog ...
Homo sapiens
EAW89322 3.1e-185 99.8 unc-13 homolog ...
Homo sapiens
BAG62068 3.5e-185 99.8 unnamed protein...
Homo sapiens
Q70J99 3.9e-185 99.8 Protein unc-13 ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB018277 1.5e-31 31.4 KIAA0734
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR010439 46 227 PF06292 Protein of unknown function DUF1041
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AAGATGTCAGTGGGTTCAGCG
Primer_r AACTCCAGGATGAAGGTCTCG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp