Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07287 |
---|---|
Accession No | AK024474 |
Clone name | as00067 |
Vector information | |
cDNA sequence | DNA sequence (4394 bp) Predicted protein sequence (574 aa) |
Source | Human spleen |
Rouge ID |
mFLJ00067
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RT-PCR-ELISA |
Primer_f | AAGATGTCAGTGGGTTCAGCG |
---|---|
Primer_r | AACTCCAGGATGAAGGTCTCG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |