Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK03387 |
---|---|
Accession No | AK024475 |
Clone name | as00068 |
Vector information | |
cDNA sequence | DNA sequence (4477 bp) Predicted protein sequence (1194 aa) |
HaloTag ORF Clone |
FHC03387
|
Flexi ORF Clone | FXC03387 |
Source | Human spleen |
Rouge ID |
mFLJ00068
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000219 | 739 | 910 | PF00621 | DH domain |
IPR001849 | 924 | 1030 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR000219 | 739 | 910 | SM00325 | DH domain |
IPR001849 | 924 | 1032 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR000219 | 735 | 911 | PS50010 | DH domain |
IPR001849 | 923 | 1030 | PS50003 | Pleckstrin-like |
RT-PCR-ELISA |
Primer_f | TCCAGGGCTGTGATGTTAACC |
---|---|
Primer_r | TGTAGGCAAATGTGTCAACCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |