Gene/Protein Characteristic Table for FLJ00068
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK03387
Accession No AK024475
Clone name as00068
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4477 bp)
Predicted protein sequence (1194 aa)
Flexi ORF Clone FXC03387
Source Human spleen
Rouge ID mFLJ00068 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4477 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1194 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15765 0 100.0 FLJ00068 protei...
Homo sapiens
Q58EX7 0 100.0 Puratrophin-1; ...
Homo sapiens
AAH82974 0 100.0 PLEKHG4 protein...
Homo sapiens
XP_001087633 0 95.2 similar to plec...
Macaca mulatta
EAW83120 0 93.2 pleckstrin homo...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB067496 2.1e-50 36.1 KIAA1909
AK024463 1.8e-42 32.6 FLJ00056
AK074057 2e-42 32.6 FLJ00128
AB051542 2e-21 29.1 KIAA1755
AB002360 1.2e-17 25.8 KIAA0362
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000219 739 910 PF00621 DH domain
IPR001849 924 1030 PF00169 Pleckstrin-like
HMMSmart IPR000219 739 910 SM00325 DH domain
IPR001849 924 1032 SM00233 Pleckstrin-like
ProfileScan IPR000219 735 911 PS50010 DH domain
IPR001849 923 1030 PS50003 Pleckstrin-like
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TCCAGGGCTGTGATGTTAACC
Primer_r TGTAGGCAAATGTGTCAACCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp