Gene/Protein Characteristic Table for FLJ00069
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04565
Accession No AK024476
Clone name as00069
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4494 bp)
Predicted protein sequence (579 aa)
Source Human spleen
Rouge ID mFLJ00069 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4494 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 579 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15766 0 100.0 FLJ00069 protei...
Homo sapiens
EAW85708 0 100.0 CTF18, chromoso...
Homo sapiens
Q8WVB6 0 100.0 Chromosome tran...
Homo sapiens
EAW85707 0 100.0 CTF18, chromoso...
Homo sapiens
AAH06437 0 100.0 CHTF18 protein ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ProfileScan IPR000862 88 168 PS50150 Replication factor C conserved domain
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGCACCCGTGAAAAGCAACAG
Primer_r ATGAGCTGCTTCGTCTGGTAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp