Gene/Protein Characteristic Table for FLJ00071
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06292
Accession No AK024478
Clone name as00071
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4194 bp)
Predicted protein sequence (250 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4194 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 250 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15768 1.7e-113 100.0 FLJ00071 protei...
Homo sapiens
EAX09191 6.7e-110 99.6 hypothetical pr...
Homo sapiens
EAX09193 6.8e-110 99.6 hypothetical pr...
Homo sapiens
CAI13794 8.3e-110 99.6 PCI domain cont...
Homo sapiens
BAA91407 8.3e-110 99.6 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000717 128 239 PF01399 Proteasome component region PCI
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGCATTGTCACCGTTCTAGTC
Primer_r CTCACAGCTCTGGTTACTTCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp