Gene/Protein Characteristic Table for FLJ00089
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07545
Accession No AK024489
Clone name as00089
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4495 bp)
Predicted protein sequence (349 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4495 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 349 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15779 6.1e-123 100.0 FLJ00089 protei...
Homo sapiens
Q9H7J1 2.5e-97 100.0 Protein phospha...
Homo sapiens
XP_001926263 3.1e-94 82.5 similar to FLJ0...
Sus scrofa
XP_547732 3e-93 96.1 similar to Prot...
Canis lupus fam...
XP_001102470 1.5e-92 96.4 similar to Prot...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005036 224 329 PF03370 Putative phosphatase regulatory subunit
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGTTGCCCATTCCTCTCATCC
Primer_r AGCAGGCTCCAGAAAAACACG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp