Gene/Protein Characteristic Table for FLJ00092
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05069
Accession No AK024490
Clone name as00092
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4259 bp)
Predicted protein sequence (369 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4259 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 369 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15780 5.6e-110 100.0 FLJ00092 protei...
Homo sapiens
EAW54641 5.4e-109 99.2 retinoic acid i...
Homo sapiens
EAW54639 5.9e-95 99.1 retinoic acid i...
Homo sapiens
XP_851864 2.9e-94 98.2 similar to reti...
Canis lupus fam...
Q6P1E1 1.9e-92 95.7 Zinc finger MIZ...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB033050 8.3e-52 98.1 KIAA1224
AK090415 4.6e-14 53.0 FLJ00315
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000104 190 204 PR00308 Antifreeze protein
IPR000104 204 215 PR00308 Antifreeze protein
ProfileScan NULL 190 215 PS50310 NULL
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATGAAACCCACTCTGTCGCAC
Primer_r TGGATTCATGGGGTTGTTGGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp